Why people are the way they are.

Humans are amazing adaptors, we can change and survive in the most unlikely of scenarios. From cold to hot, high to low, wet to dry, we can adapt for a short time, or even a long time if we need to live. Heat is one great example of something Humans need to adapt to. More humans die from heat than cold every year, why? because heat can cause the body to overdo it and shut down. Humans adapt to this stress in several ways, by sweating, by releasing heat through the head and appendages, by slowing systems down, and craving salt. Peoples whole body structure can change to adapt to hot environments, for example, the long lean bodies of people in Africa are far better at expelling heat than the squat bodies of people in Antarctica. Because of this we should understand that we should not judge people on how they look because often there is a reason why. People in different parts of the world look different for a reason, a very good reason that has to do with their environment, studying these reasons helps us understand people better.

Language

Language is one of the most critical parts of civilizations, the average person says 16,000 words a day. We communicate and express ourselves, who we are and what we want through words and speech. What if this was taken away from us? What if we had no words, no way of writing, not even hand motions? I tried this for fifteen minutes and utterly failed. The normal patterns of conversation, questions and answers, stories and laughter were lost and I discovered nearly nothing new about the person I was speaking to. My impressions of the person I was speaking to, my younger (but not little) brother was that he was even more hilarious than I though, his ridiculous pointing and blinking and facial expressions succumbed us to laughter in minutes, he is always funny but he altered his personality from outgoing to outrageous to fit the conversation. If I was not related to him and knew his though processes, say if he was from a different culture entirely, instead of from my family, I imagine that the conversation would go entirely different we probably still would of brought each other to laughter with the way we were acting. We have one of the most complex languages yet so I imagine that someone from a different culture would have a hard time keeping up. Also those who have a disability that inhibits them from understanding language would have a hard time realizing what was trying to be said.

Next I was asked to spend 15 minutes conversing without physical embellishments, this was hard, but not as hard for me. I was able to do it, but I am extremely flamboyant with my facial expressions and hands when I talk, especially when I get excited, so is my brother. We were affected by these limitations by how hard it was to express what you were feeling or how it made us feel. It is hard to tell whether you are happy or sad about a sentence if there is no expression behind it. This shows how critical signs are in our language, we need expression to show what we mean with our words. Many people with autism or other social impairments have a hard time with social cues and would probably have a hard time picking up on these things. Language is a critical part of our culture, beyond the speaking and writing the social cues behind them are also critical. These experiments really expressed this to me.

Piltdown Hoax

The Piltdown Hoax began when Charles Dawson received a fraction of a scull said to be found at the Piltdown Gravel pit in East Sussex, England in December of 1912. He and Arthur Smith Woodward began to uncover the site but Dawson only found more pieces on his own. The scull found had most pieces including a jaw bone, it seemed to be very similar to a human scull but with several differences, it was thought to be the missing link between humans and apes. This find was accepted easily by the public, and though somewhat questioned by the scientific community, Dawsons respected reputation caused very few, if no one to straight up question it. Therefore it stood, the answer to the question of the missing link. For forty years it stood as the answer, until, after Dawsons death, when others were finally able to see the evidence up close and it was discovered that the find was really a combination of a human scull from the medieval era, the jaw of an orangutang and some fossilized ape teeth, all that had been stained to match, and the teeth had been shaped to fit. In other words, it was a false, a hoax, created to bring fame to Dawsons name, or for the country of England. In this case mans desire for glory or recognition got in the way of true science and set the community forty years back. However what was learned from this hoax is invaluable. It is now widely understood how critical it is to have peer evaluation and feedback, and to not take anything at face value, no matter the name behind it. So even though we can not remove man from the picture, we can lessen the margin for error by checking and rechecking against peer information. Something we can all learn from this scam is to never just swallow what people are telling us, but to research for ourselves. Especially in this era of information overload.

locomotion in primates.

Lemurs (Prosimians/Strepsirhini)

a. A thorough description of the environment in which the primates lives.

Lemurs are primates that are indigenous to Madagascar, most live among the trees, living in branches, however some types do spend a majority of time on the ground.

b. A description of your specified character trait for that primate.

Lemurs move quadrupedually on the ground and in the trees, using all four limbs to move and their tail for balance.

c. A discussion on how the primate’s trait expression has been influenced by its environment, i.e., how can the trait be viewed as an adaptation to the primate’s environment. (10 pts total)

Lemurs locomotors movements have developed as a result of their need to move quickly up or down or across the floor quickly. They have adapted to climbing trees as a result of running from preditors.

d. An image of that primate, preferably displaying the trait you are studying, if possible. (5 pts total

source: http://www.theprimata.com/lemur_catta.html

Spider Monkey (New World Monkey/Platyrrhini)

a. A thorough description of the environment in which the primates lives.

Gibbon (Lesser ape/Hylobatidae)

a. A thorough description of the environment in which the primates lives.

Gibbons are a small monkey that live in the trees.

b. A description of your specified character trait for that primate.

Gibbon monkeys use brachiation, the swinging by arms to get around.

c. A discussion on how the primate’s trait expression has been influenced by its environment, i.e., how can the trait be viewed as an adaptation to the primate’s environment.

Gibbons live among the trees, this causes them to have the need to get between branches, they have developed a way to swing among them.

d. An image of that primate, preferably displaying the trait you are studying, if possible.

Source: http://nationalzoo.si.edu/Animals/Primates/Facts/FactSheets/Gibbons/default.cfm

Baboon (Old World Monkey/Cercopithecidae)

a. A thorough description of the environment in which the primates lives. (10 pts total)

Baboon’s dwell in flat lands, this requires much ‘walking’ around, as opposed to climbing like other primates.

b. A description of your specified character trait for that primate. (10 pts total)

Baboon’s walk on all fours, otherwise called quadrupedually.

c. A discussion on how the primate’s trait expression has been influenced by its environment, i.e., how can the trait be viewed as an adaptation to the primate’s environment.

Baboons environment has caused them to need to move around quickly and with agility, this has caused them to walk on all fours, the quickest and most convienent way for them to move.

d. An image of that primate, preferably displaying the trait you are studying, if possible. (5 pts total

source: http://www.theprimata.com/theropithecus_gelada.html

Spider Monkey (New World Monkey/Platyrrhini)

a. A thorough description of the environment in which the primates lives.

Spider Monkeys live in highly forested areas and spend most of their time among the trees.

b. A description of your specified character trait for that primate.

Spider Monkeys use several different types of locomotion. They use quadupedial motion when on the ground. Suspensory movement when hanging, climbing or moving through the trees, and bipedialism when leaping from two feet towards another branch.

c. A discussion on how the primate’s trait expression has been influenced by its environment, i.e., how can the trait be viewed as an adaptation to the primate’s environment.

The spider monkeys use of several different traits can be seen as an adaption towards the several different environments they are placed in. They utilize different motions depending on what they are doing.

d. An image of that primate, preferably displaying the trait you are studying, if possible.

Source: http://angrydmonkey.com/different-locomotion-in-spider-monkeys-study.html

Chimpanzee (Great ape/Hominidae)

a. A thorough description of the environment in which the primates lives.

Chimpanzees are native to rainforests and move among the trees, but also spend some time on the ground.

b. A description of your specified character trait for that primate.

Chimpanzees utilize both quadual movement and suspensor movement, walking on all fours and swinging through trees.

c. A discussion on how the primate’s trait expression has been influenced by its environment, i.e., how can the trait be viewed as an adaptation to the primate’s environment.

Chimpanzees environment of spending time in the trees and on the ground has caused them to develop two ways of moving.

d. An image of that primate, preferably displaying the trait you are studying, if possible.

Source: http://www.theprimata.com/chimp_locomotion.html

[human leg]

[insect leg]

[fish bone structure]

[mammals ear structure]

1. For your homologus traits provide the following information

a. Briefly describe the two different species that possess the homologus trait.

The internal workings of the ear, including the stapes, malleus and incus are homologus to the parts in the jaw of a fish and the arches of their gills.

b. Describe the homologus trait of each species, focusing on the differences in structure and

function of the trait. Why do these homologus traits exhibit differences between the two

species? Make sure your explanation is clear and complete.

The bones in mammals ears are small, they all descend from a single bone that was part of the jaw called the hoymadibular bone. This bone is the same bone that forms the jaw of fish. This bone is homologus to mammals and fish but developed in different ways because of different needs of the species.

c. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologus trait?

Both mammals and fish descended from tetrapods.

d. Provide an image of each species in this comparison.

[above]

2. For your analogous traits provide the following information (25 pts):

a. Briefly describe the two different species that possess the analogous trait. (5 pts)

Insects and Mammals both have legs, but they are from different origins and for different reasons.

b. Describe the analogous trait of each species, focusing on the similarities in structure and

function of the trait. Clearly explain why these analogous traits exhibit similarities between the

two species.

The legs of insects are jointed leg segments called podomeres. The legs of Mammals are bones that are jointed with ligaments and rotate in sockets.

c. All pairs of organisms share some common ancestor if you go back far enough in time. Did the common ancestor of these two species possess this analogous trait? Why or why not?

The common ancestor of these two species must have had legs, because they both obviously have legs.

d. Provide an image of each species in this comparison.

[above]

my dna strand!

GGCTTACCTTGGGCGTTTCTGTCGGCCTGCTTTCGCCG

Darwin: Influences.

While there were many historical and scientific changes and influences that led to the acceptance of Darwin’s Theory of Natural Selection, the person I believe influenced him the most was Alfred Russel Wallace. Wallace had similar ideas and passions as Darwin, they both had an unusual fascination with nature and where it came from, and were unable to accept the answers that had been given to them. Like Darwin, Wallace underwent an expedition, in hope of understanding nature further. His journey however was to the Amazon, not the Galapagos Islands he studied there and collected many specimens, unfortunately though all his work was lost when his ship caught fire in the Atlantic. This pushed him back severely but within two years he had published his finding. Later he traveled in the Far East, extending his studies. Throughout this time, he and Darwin withheld a friendship and a mutual understanding built through science. They both believed in Natural Selection before it was a known concept and they forged a bond through this. Wallace sent Darwin sample from his collecting in China and the Orient and they discussed ideas. Although they did not agree most of the time on many issues, this friendship was one that pushed each other to think, they both produced wonderful work, one was more popular than the other, but they were both great thinkers. Wallace influenced Darwin for the better, he encouraged his writing, questioned his theory and pushed Darwin to further himself and the science.

The aspect of evolution that Wallace most influenced Darwin on is probably the statement “If the environment changes, the traits that are helpful or adaptive to that environment will be different. Organisms with those new adaptive traits will have greater reproductive success than others and those new beneficial traits will spread, producing a change in the population. This is the process of natural selection, essentially the process of the natural environment selecting the organisms that will be most successful” The idea of Natural Selection was one that was reached by both men in different ways but at almost the same time. To Wallace this idea was a simple one, more of a though, and though he wrote papers on it, it never truly became a theory under his work. His work did however push Darwin to publish his work and to develop his theory more clearly.

Darwin had already started to develop his theory by the time that he knew Wallace had a similar one, and would likely of continued to think on it and write about it, but I think that it was Wallace who pushed Darwin to further his work. The competition that comes from a peer working on a similar topic pushes you and challenges you to work harder and to do better. Also, the differences in their work would push Darwin to prove what he thought was right. I think that Wallace was critical to Darwin’s Theory’s development.

The Church at this time was used to being under attack, this was not the first theory that challenged what the church believed or thought. A theory like this was challenging the very basis of scripture. This deterred Darwin only a bit, he was more concerned about what his wife thought than the Church, when she passed so did his fear of the church. The Church only deterred Darwin a bit from publishing his work “The Origin of Species”.

source: aboutdarwin.com