locomotion in primates.

Lemurs (Prosimians/Strepsirhini)

a. A thorough description of the environment in which the primates lives.

Lemurs are primates that are indigenous to Madagascar, most live among the trees, living in branches, however some types do spend a majority of time on the ground.

b. A description of your specified character trait for that primate.

Lemurs move quadrupedually on the ground and in the trees, using all four limbs to move and their tail for balance.

c. A discussion on how the primate’s trait expression has been influenced by its environment, i.e., how can the trait be viewed as an adaptation to the primate’s environment. (10 pts total)

Lemurs locomotors movements have developed as a result of their need to move quickly up or down or across the floor quickly. They have adapted to climbing trees as a result of running from preditors.

d. An image of that primate, preferably displaying the trait you are studying, if possible. (5 pts total

source: http://www.theprimata.com/lemur_catta.html

Spider Monkey (New World Monkey/Platyrrhini)

a. A thorough description of the environment in which the primates lives.

Gibbon (Lesser ape/Hylobatidae)

a. A thorough description of the environment in which the primates lives.

Gibbons are a small monkey that live in the trees.

b. A description of your specified character trait for that primate.

Gibbon monkeys use brachiation, the swinging by arms to get around.

c. A discussion on how the primate’s trait expression has been influenced by its environment, i.e., how can the trait be viewed as an adaptation to the primate’s environment.

Gibbons live among the trees, this causes them to have the need to get between branches, they have developed a way to swing among them.

d. An image of that primate, preferably displaying the trait you are studying, if possible.

Source: http://nationalzoo.si.edu/Animals/Primates/Facts/FactSheets/Gibbons/default.cfm

Baboon (Old World Monkey/Cercopithecidae)

a. A thorough description of the environment in which the primates lives. (10 pts total)

Baboon’s dwell in flat lands, this requires much ‘walking’ around, as opposed to climbing like other primates.

b. A description of your specified character trait for that primate. (10 pts total)

Baboon’s walk on all fours, otherwise called quadrupedually.

c. A discussion on how the primate’s trait expression has been influenced by its environment, i.e., how can the trait be viewed as an adaptation to the primate’s environment.

Baboons environment has caused them to need to move around quickly and with agility, this has caused them to walk on all fours, the quickest and most convienent way for them to move.

d. An image of that primate, preferably displaying the trait you are studying, if possible. (5 pts total

source: http://www.theprimata.com/theropithecus_gelada.html

Spider Monkey (New World Monkey/Platyrrhini)

a. A thorough description of the environment in which the primates lives.

Spider Monkeys live in highly forested areas and spend most of their time among the trees.

b. A description of your specified character trait for that primate.

Spider Monkeys use several different types of locomotion. They use quadupedial motion when on the ground. Suspensory movement when hanging, climbing or moving through the trees, and bipedialism when leaping from two feet towards another branch.

c. A discussion on how the primate’s trait expression has been influenced by its environment, i.e., how can the trait be viewed as an adaptation to the primate’s environment.

The spider monkeys use of several different traits can be seen as an adaption towards the several different environments they are placed in. They utilize different motions depending on what they are doing.

d. An image of that primate, preferably displaying the trait you are studying, if possible.

Source: http://angrydmonkey.com/different-locomotion-in-spider-monkeys-study.html

Chimpanzee (Great ape/Hominidae)

a. A thorough description of the environment in which the primates lives.

Chimpanzees are native to rainforests and move among the trees, but also spend some time on the ground.

b. A description of your specified character trait for that primate.

Chimpanzees utilize both quadual movement and suspensor movement, walking on all fours and swinging through trees.

c. A discussion on how the primate’s trait expression has been influenced by its environment, i.e., how can the trait be viewed as an adaptation to the primate’s environment.

Chimpanzees environment of spending time in the trees and on the ground has caused them to develop two ways of moving.

d. An image of that primate, preferably displaying the trait you are studying, if possible.

Source: http://www.theprimata.com/chimp_locomotion.html

[human leg]

[insect leg]

[fish bone structure]

[mammals ear structure]

1. For your homologus traits provide the following information

a. Briefly describe the two different species that possess the homologus trait.

The internal workings of the ear, including the stapes, malleus and incus are homologus to the parts in the jaw of a fish and the arches of their gills.

b. Describe the homologus trait of each species, focusing on the differences in structure and

function of the trait. Why do these homologus traits exhibit differences between the two

species? Make sure your explanation is clear and complete.

The bones in mammals ears are small, they all descend from a single bone that was part of the jaw called the hoymadibular bone. This bone is the same bone that forms the jaw of fish. This bone is homologus to mammals and fish but developed in different ways because of different needs of the species.

c. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologus trait?

Both mammals and fish descended from tetrapods.

d. Provide an image of each species in this comparison.

[above]

2. For your analogous traits provide the following information (25 pts):

a. Briefly describe the two different species that possess the analogous trait. (5 pts)

Insects and Mammals both have legs, but they are from different origins and for different reasons.

b. Describe the analogous trait of each species, focusing on the similarities in structure and

function of the trait. Clearly explain why these analogous traits exhibit similarities between the

two species.

The legs of insects are jointed leg segments called podomeres. The legs of Mammals are bones that are jointed with ligaments and rotate in sockets.

c. All pairs of organisms share some common ancestor if you go back far enough in time. Did the common ancestor of these two species possess this analogous trait? Why or why not?

The common ancestor of these two species must have had legs, because they both obviously have legs.

d. Provide an image of each species in this comparison.

[above]

my dna strand!

GGCTTACCTTGGGCGTTTCTGTCGGCCTGCTTTCGCCG

Darwin: Influences.

While there were many historical and scientific changes and influences that led to the acceptance of Darwin’s Theory of Natural Selection, the person I believe influenced him the most was Alfred Russel Wallace. Wallace had similar ideas and passions as Darwin, they both had an unusual fascination with nature and where it came from, and were unable to accept the answers that had been given to them. Like Darwin, Wallace underwent an expedition, in hope of understanding nature further. His journey however was to the Amazon, not the Galapagos Islands he studied there and collected many specimens, unfortunately though all his work was lost when his ship caught fire in the Atlantic. This pushed him back severely but within two years he had published his finding. Later he traveled in the Far East, extending his studies. Throughout this time, he and Darwin withheld a friendship and a mutual understanding built through science. They both believed in Natural Selection before it was a known concept and they forged a bond through this. Wallace sent Darwin sample from his collecting in China and the Orient and they discussed ideas. Although they did not agree most of the time on many issues, this friendship was one that pushed each other to think, they both produced wonderful work, one was more popular than the other, but they were both great thinkers. Wallace influenced Darwin for the better, he encouraged his writing, questioned his theory and pushed Darwin to further himself and the science.

The aspect of evolution that Wallace most influenced Darwin on is probably the statement “If the environment changes, the traits that are helpful or adaptive to that environment will be different. Organisms with those new adaptive traits will have greater reproductive success than others and those new beneficial traits will spread, producing a change in the population. This is the process of natural selection, essentially the process of the natural environment selecting the organisms that will be most successful” The idea of Natural Selection was one that was reached by both men in different ways but at almost the same time. To Wallace this idea was a simple one, more of a though, and though he wrote papers on it, it never truly became a theory under his work. His work did however push Darwin to publish his work and to develop his theory more clearly.

Darwin had already started to develop his theory by the time that he knew Wallace had a similar one, and would likely of continued to think on it and write about it, but I think that it was Wallace who pushed Darwin to further his work. The competition that comes from a peer working on a similar topic pushes you and challenges you to work harder and to do better. Also, the differences in their work would push Darwin to prove what he thought was right. I think that Wallace was critical to Darwin’s Theory’s development.

The Church at this time was used to being under attack, this was not the first theory that challenged what the church believed or thought. A theory like this was challenging the very basis of scripture. This deterred Darwin only a bit, he was more concerned about what his wife thought than the Church, when she passed so did his fear of the church. The Church only deterred Darwin a bit from publishing his work “The Origin of Species”.

source: aboutdarwin.com